Optimizing breast cancer diagnosis with photoacoustic imaging: An analysis of intratumoral and peritumoral radiomics.

Background: The differentiation between benign and malignant breast tumors extends beyond morphological structures to encompass functional alterations within the nodules. The combination of photoacoustic (PA) imaging and radiomics unveils functional insights and intricate details that are imperceptible to the naked eye. Purpose: This study aims to assess the efficacy of PA imaging in breast cancer radiomics, focusing on the impact of peritumoral region size on radiomic model accuracy. Materials and methods: From January 2022 to November 2023, data were collected from 358 patients with breast nodules, diagnosed via PA/US examination and classified as BI-RADS 3-5. The study used the largest lesion dimension in PA images to define the region of interest, expanded by 2 mm, 5 mm, and 8 mm, for extracting radiomic features. Techniques from statistics and machine learning were applied for feature selection, and logistic regression classifiers were used to build radiomic models. These models integrated both intratumoral and peritumoral data, with logistic regressions identifying key predictive features. Results: The developed nomogram, combining 5 mm peritumoral data with intratumoral and clinical features, showed superior diagnostic performance, achieving an AUC of 0.950 in the training cohort and 0.899 in validation. This model outperformed those based solely on clinical features or other radiomic methods, with the 5 mm peritumoral region proving most effective in identifying malignant nodules. Conclusion: This research demonstrates the significant potential of PA imaging in breast cancer radiomics, especially the advantage of integrating 5 mm peritumoral with intratumoral features. This approach not only surpasses models based on clinical data but also underscores the importance of comprehensive radiomic analysis in accurately characterizing breast nodules.

Competitive adsorption of microRNA-532-3p by circular RNA SOD2 activates Thioredoxin Interacting Protein/NLR family pyrin domain containing 3 pathway and promotes pyroptosis of non-alcoholic fatty hepatocytes.

OBJECTIVE: There is a growing body of evidence indicating that pyroptosis, a programmed cell death mechanism, plays a crucial role in the exacerbation of inflammation and fibrosis in the pathogenesis of non-alcoholic fatty liver disease (NAFLD). Circular RNAs (circRNAs), functioning as vital regulators within NAFLD, have been shown to mediate the process of cell pyroptosis. This study aims to elucidate the roles and mechanisms of circRNAs in NAFLD. METHODS: Utilizing a high-fat diet (HFD)-induced rat model for in vivo experimentation and hepatocytes treated with palmitic acid (PA) for in vitro models, we identified circular RNA SOD2 (circSOD2) as our circRNA of interest through analysis with the circMine database. The expression levels of associated genes and pyroptosis-related proteins were determined using quantitative real-time polymerase chain reaction and Western blotting, alongside immunohistochemistry. Serum liver function markers, cellular inflammatory cytokines, malondialdehyde, lactate dehydrogenase levels, and mitochondrial membrane potential, were assessed using enzyme-linked immunosorbent assay, standard assay kits, or JC-1 staining. Flow cytometry was employed to detect pyroptotic cells, and lipid deposition in liver tissues was observed via Oil Red O staining. The interactions between miR-532-3p/circSOD2 and miR-532-3p/Thioredoxin Interacting Protein (TXNIP) were validated through dual-luciferase reporter assays and RNA immunoprecipitation experiments. RESULTS: Our findings demonstrate that, in both in vivo and in vitro NAFLD models, there was an upregulation of circSOD2 and TXNIP, alongside a downregulation of miR-532-3p. Mechanistically, miR-532-3p directly bound to the 3'-UTR of TXNIP, thereby mediating inflammation and cell pyroptosis through targeting the TXNIP/NLR family pyrin domain containing 3 (NLRP3) inflammasome signaling pathway. circSOD2 directly interacted with miR-532-3p, relieving the suppression on the TXNIP/NLRP3 signaling pathway. Functionally, the knockdown of circSOD2 or TXNIP improved hepatocyte pyroptosis; the deletion of miR-532-3p reversed the effects of circSOD2 knockdown, and the deletion of TXNIP reversed the effects of circSOD2 overexpression. Furthermore, the knockdown of circSOD2 significantly mitigated the progression of NAFLD in vivo. CONCLUSION: circSOD2 competitively sponges miR-532-3p to activate the TXNIP/NLRP3 inflammasome signaling pathway, promoting pyroptosis in NAFLD.

Phase Engineering of Zirconium MOFs Enables Efficient Osmotic Energy Conversion: Structural Evolution Unveiled by Direct Imaging.

Creating structural defects in a controlled manner within metal-organic frameworks (MOFs) poses a significant challenge for synthesis, and concurrently, identifying the types and distributions of these defects is also a formidable task for characterization. In this study, we demonstrate that by employing 2-sulfonylterephthalic acid as the ligand for synthesizing Zr (or Hf)-based MOFs, a crystal phase transformation from the common fcu topology to the rare jmt topology can be easily facilitated using a straightforward mixed-solvent strategy. The jmt phase, characterized by an extensively open framework, can be considered a derivative of the fcu phase, generated through the introduction of missing-cluster defects. We have explicitly identified both MOF phases, their intermediate states, and the novel core-shell structures they form using ultralow-dose high-resolution transmission electron microscopy. In addition to facilitating phase engineering, the incorporation of sulfonic groups in MOFs imparts ionic selectivity, making them applicable for osmotic energy harvesting through mixed matrix membrane fabrication. The membrane containing the jmt-phase MOF exhibits an exceptionally high peak power density of 10.08 W m-2 under a 50-fold salinity gradient (NaCl: 0.5 M|0.01 M), which surpasses the threshold of 5 W m-2 for commercial applications and can be attributed to the combination of large pore size, extensive porosity, and abundant sulfonic groups in this novel MOF material.

Work Function-Guided Electrocatalyst Design.

The development of high-performance electrocatalysts for energy conversion reactions is crucial for advancing global energy sustainability. The design of catalysts based on their electronic properties (e.g., work function) has gained significant attention recently. Although numerous reviews on electrocatalysis have been provided, no such reports on work function-guided electrocatalyst design are available. Herein, a comprehensive summary of the latest advancements in work function-guided electrocatalyst design for diverse electrochemical energy applications is provided. This includes the development of work function-based catalytic activity descriptors, and the design of both monolithic and heterostructural catalysts. The measurement of work function is first discussed and the applications of work function-based catalytic activity descriptors for various reactions are fully analyzed. Subsequently, the work function-regulated material-electrolyte interfacial electron transfer (IET) is employed for monolithic catalyst design, and methods for regulating the work function and optimizing the catalytic performance of catalysts are discussed. In addition, key strategies for tuning the work function-governed material-material IET in heterostructural catalyst design are examined. Finally, perspectives on work function determination, work function-based activity descriptors, and catalyst design are put forward to guide future research. This work paves the way to the work function-guided rational design of efficient electrocatalysts for sustainable energy applications.

Iron-containing nanominerals for sustainable phosphate management: A comprehensive review and future perspectives.

Adsorption, which is a quick and effective method for phosphate management, can effectively address the crisis of phosphorus mineral resources and control eutrophication. Phosphate management systems typically use iron-containing nanominerals (ICNs) with large surface areas and high activity, as well as modified ICNs (mICNs). This paper comprehensively reviews phosphate management by ICNs and mICNs in different water environments. mICNs have a higher affinity for phosphates than ICNs. Phosphate adsorption on ICNs and mICNs occurs through mechanisms such as surface complexation, surface precipitation, electrostatic ligand exchange, and electrostatic attraction. Ionic strength influences phosphate adsorption by changing the surface potential and isoelectric point of ICNs and mICNs. Anions exhibit inhibitory effects on ICNs and mICNs in phosphate adsorption, while cations display a promoting effect. More importantly, high concentrations and molecular weights of natural organic matter can inhibit phosphate adsorption by ICNs and mICNs. Sodium hydroxide has high regeneration capability for ICNs and mICNs. Compared to ICNs with high crystallinity, those with low crystallinity are less likely to desorb. ICNs and mICNs can effectively manage municipal wastewater, eutrophic seawater, and eutrophic lakes. Adsorption of ICNs and mICNs saturated with phosphate can be used as fertilizers in agricultural production. Notably, mICNs and ICNs have positive and negative effects on microorganisms and aquatic organisms in soil. Finally, this study introduces the following: trends and prospects of machine learning-guided mICN design, novel methods for modified ICNs, mICN regeneration, development of mICNs with high adsorption capacity and selectivity for phosphate, investigation of competing ions in different water environments by mICNs, and trends and prospects of in-depth research on the adsorption mechanism of phosphate by weakly crystalline ferrihydrite. This comprehensive review can provide novel insights into the research on high-performance mICNs for phosphate management in the future.

CD-Net: Cascaded 3D Dilated convolutional neural network for pneumonia lesion segmentation.

COVID-19 is a global pandemic that has caused significant global, social, and economic disruption. To effectively assist in screening and monitoring diagnosed cases, it is crucial to accurately segment lesions from Computer Tomography (CT) scans. Due to the lack of labeled data and the presence of redundant parameters in 3D CT, there are still significant challenges in diagnosing COVID-19 in related fields. To address the problem, we have developed a new model called the Cascaded 3D Dilated convolutional neural network (CD-Net) for directly processing CT volume data. To reduce memory consumption when cutting volume data into small patches, we initially design a cascade architecture in CD-Net to preserve global information. Then, we construct a Multi-scale Parallel Dilated Convolution (MPDC) block to aggregate features of different sizes and simultaneously reduce the parameters. Moreover, to alleviate the shortage of labeled data, we employ classical transfer learning, which requires only a small amount of data while achieving better performance. Experimental results conducted on the different public-available datasets verify that the proposed CD-Net has reduced the negative-positive ratio and outperformed other existing segmentation methods while requiring less data.

Bioinformatics Analysis and Experimental Validation for Exploring Key Molecular Markers for Glioblastoma.

Glioblastoma (GBM) is the most common primary intracranial malignancy with a very low survival rate. Exploring key molecular markers for GBM can help with early diagnosis, prognostic prediction, and recurrence monitoring. This study aims to explore novel biomarkers for GBM via bioinformatics analysis and experimental verification. Dataset GSE103229 was obtained from the GEO database to search differentially expressed lncRNA (DELs), mRNAs (DEMs), and miRNAs (DEMis). Hub genes were selected to establish competing endogenous RNA (ceRNA) networks. The GEPIA database was employed for the survival analysis and expression detection of hub genes. Hub gene expression in GBM tissue samples and cell lines was validated using RT-qPCR. Western blotting was employed for protein expression evaluation. SYT1 overexpression vector was transfected in GBM cells. CCK-8 assay and flow cytometry were performed to detect the malignant phenotypes of GBM cells. There were 901 upregulated and 1086 downregulated DEMs identified, which were prominently enriched in various malignancy-related functions and pathways. Twenty-two hub genes were selected from PPI networks. Survival analysis and experimental validation revealed that four hub genes were tightly associated with GBM prognosis and progression, including SYT1, GRIN2A, KCNA1, and SYNPR. The four genes were significantly downregulated in GBM tissues and cell lines. Overexpressing SYT1 alleviated the proliferation and promoted the apoptosis of GBM cells in vitro. We identify four genes that may be potential molecular markers of GBM, which may provide new ideas for improving early diagnosis and prediction of the disease.

Three-dimensional electro-neural interfaces electroplated on subretinal prostheses.

Objective.Retinal prosthetics offer partial restoration of sight to patients blinded by retinal degenerative diseases through electrical stimulation of the remaining neurons. Decreasing the pixel size enables increasing prosthetic visual acuity, as demonstrated in animal models of retinal degeneration. However, scaling down the size of planar pixels is limited by the reduced penetration depth of the electric field in tissue. We investigated 3-dimensional (3d) structures on top of photovoltaic arrays for enhanced penetration of the electric field, permitting higher resolution implants.Approach.3D COMSOL models of subretinal photovoltaic arrays were developed to accurately quantify the electrodynamics during stimulation and verified through comparison to flat photovoltaic arrays. Models were applied to optimize the design of 3D electrode structures (pillars and honeycombs). Return electrodes on honeycomb walls vertically align the electric field with bipolar cells for optimal stimulation. Pillars elevate the active electrode, thus improving proximity to target neurons. The optimized 3D structures were electroplated onto existing flat subretinal prostheses.Main results.Simulations demonstrate that despite exposed conductive sidewalls, charge mostly flows via high-capacitance sputtered iridium oxide films topping the 3D structures. The 24µm height of honeycomb structures was optimized for integration with the inner nuclear layer cells in the rat retina, whilst 35µm tall pillars were optimized for penetrating the debris layer in human patients. Implantation of released 3D arrays demonstrates mechanical robustness, with histology demonstrating successful integration of 3D structures with the rat retinain-vivo.Significance. Electroplated 3D honeycomb structures produce vertically oriented electric fields, providing low stimulation thresholds, high spatial resolution, and high contrast for pixel sizes down to 20µm. Pillar electrodes offer an alternative for extending past the debris layer. Electroplating of 3D structures is compatible with the fabrication process of flat photovoltaic arrays, enabling much more efficient retinal stimulation.

A Spiking Artificial Vision Architecture Based on Fully Emulating the Human Vision.

Intelligent vision necessitates the deployment of detectors that are always-on and low-power, mirroring the continuous and uninterrupted responsiveness characteristic of human vision. Nonetheless, contemporary artificial vision systems attain this goal by the continuous processing of massive image frames and executing intricate algorithms, thereby expending substantial computational power and energy. In contrast, biological data processing, based on event-triggered spiking, has higher efficiency and lower energy consumption. Here, this work proposes an artificial vision architecture consisting of spiking photodetectors and artificial synapses, closely mirroring the intricacies of the human visual system. Distinct from previously reported techniques, the photodetector is self-powered and event-triggered, outputting light-modulated spiking signals directly, thereby fulfilling the imperative for always-on with low-power consumption. With the spiking signals processing through the integrated synapse units, recognition of graphics, gestures, and human action has been implemented, illustrating the potent image processing capabilities inherent within this architecture. The results prove the 90% accuracy rate in human action recognition within a mere five epochs utilizing a rudimentary artificial neural network. This novel architecture, grounded in spiking photodetectors, offers a viable alternative to the extant models of always-on low-power artificial vision system.

A two-dimensional metal-organic framework assembled from scandium-based cages for the selective capture of sulfur hexafluoride.

Herein, we report the synthesis of a two-dimensional metal-organic framework (MOF), assembled from octahedral metal-organic cages featuring phenanthroline-based carboxylate linkers and µ3-oxo-centered trinuclear Sc(III) inorganic building blocks. We study the performance of this MOF towards the capture of sulfur hexafluoride (SF6). On account of its structural features and porous nature, this MOF displays an SF6 uptake capacity of 0.92 mmol g-1 at 0.1 bar and an isosteric heat of adsorption of about 30.7 kJ mol-1 for SF6, illustrating its potential application for the selective capture of SF6 from N2. In addition, we study the adsorptive binding mechanism of SF6 and N2 inside this MOF via molecular simulations.

Anti-tumor effect and mechanism of the total biflavonoid extract from S doederleinii on human cervical cancer cells in vitro and in vivo.

In this study, the therapeutic effect and possible mechanism of the total biflavonoid extract of Selaginella doederleinii Hieron (SDTBE) against cervical cancer were originally investigated in vitro and in vivo. First, the inhibition of SDTBE on proliferation of cervical cancer HeLa cells was evaluated, followed by morphological observation with AO/EB staining, Annexin V/PI assay, and autophagic flux monitoring to evaluate the possible effect of SDTBE on cell apoptosis and autophagy. Cell cycle, as well as mitochondrial membrane potential (ΔÑ°m), was detected with flow cytometry. Further, the apoptosis related protein expression and the autophagy related gene LC3 mRNA transcription level were analyzed by Western blot (WB) and real-time quantitative polymerase chain reaction (RT-qPCR), respectively. Finally, the anti-cervical cancer effect of the SDTBE was also validated in vivo in HeLa cells grafts mice. As results, SDTBE inhibited HeLa cells proliferation with the IC50 values of 49.05 ± 6.76 and 44.14 ± 4.75 µg/mL for 48 and 72 h treatment, respectively. The extract caused mitochondrial ΔÑ° loss, induced cell apoptosis by upregulating Bax, downregulating Bcl-2, activating Caspase-9 and Caspase-3, promoting cell autophagy and blocking the cell cycle in G0/G1 phase. Furthermore, 100, 200, and 300 mg/kg SDTBE suppressed the growth of HeLa cells xenografts in mice with the mean inhibition rates, 25.3 %, 57.5 % and 62.9 %, respectively, and the change of apoptosis related proteins and microvascular density was confirmed in xenografts by immunohistochemistry analysis. The results show that SDTBE possesses anti-cervical cancer effect, and the mechanism involves in activating Caspase-dependent mitochondrial apoptosis pathway.

First report of Root-Knot Nematode Meloidogyne enterolobii infecting coriander in Shaanxi, Northern China.

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

First Report of Meloidogyne incognita on Coral dealbatus in Shaanxi, China.

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

Modular synthesis of 1,2-azaborines via ring-opening BN-isostere benzannulation.

1,2-Azaborines represent a unique class of benzene isosteres that have attracted interest for developing pharmaceuticals with better potency and bioavailability. However, it remains a long-standing challenge to prepare monocyclic 1,2-azaborines, particularly multi-substituted ones, in an efficient and modular manner. Here we report a straightforward method to directly access diverse multi-substituted 1,2-azaborines from readily available cyclopropyl imines/ketones and dibromoboranes under relatively mild conditions. The reaction is scalable, shows a broad substrate scope, and tolerates a range of functional groups. The utility of this method is demonstrated in the concise syntheses of BN isosteres of a PD-1/PD-L1 inhibitor and pyrethroid insecticide, bifenthrin. Combined experimental and computational mechanistic studies suggest that the reaction pathway involves boron-mediated cyclopropane ring-opening and base-mediated elimination, followed by an unusual low-barrier 6π-electrocyclization accelerated by the BN/CC isomerism. This method is anticipated to find applications for the synthesis of BN-isostere analogues in medicinal chemistry, and the mechanistic insights gained here may guide developing other boron-mediated electrocyclizations.

Polysaccharide of Alocasia cucullata Exerts Antitumor Effect by Regulating Bcl-2, Caspase-3 and ERK1/2 Expressions during Long-Time Administration.

OBJECTIVE: To study the in vitro and in vivo antitumor effects of the polysaccharide of Alocasia cucullata (PAC) and the underlying mechanism. METHODS: B16F10 and 4T1 cells were cultured with PAC of 40 µg/mL, and PAC was withdrawn after 40 days of administration. The cell viability was detected by cell counting kit-8. The expression of Bcl-2 and Caspase-3 proteins were detected by Western blot and the expressions of ERK1/2 mRNA were detected by quantitative real-time polymerase chain reaction (qRT-PCR). A mouse melanoma model was established to study the effect of PAC during long-time administration. Mice were divided into 3 treatment groups: control group treated with saline water, positive control group (LNT group) treated with lentinan at 100 mg/(kg·d), and PAC group treated with PAC at 120 mg/(kg·d). The pathological changes of tumor tissues were observed by hematoxylin-eosin staining. The apoptosis of tumor tissues was detected by TUNEL staining. Bcl-2 and Caspase-3 protein expressions were detected by immunohistochemistry, and the expressions of ERK1/2, JNK1 and p38 mRNA were detected by qRT-PCR. RESULTS: In vitro, no strong inhibitory effects of PAC were found in various tumor cells after 48 or 72 h of administration. Interestingly however, after 40 days of cultivation under PAC, an inhibitory effect on B16F10 cells was found. Correspondingly, the long-time administration of PAC led to downregulation of Bcl-2 protein (P<0.05), up-regulation of Caspase-3 protein (P<0.05) and ERK1 mRNA (P<0.05) in B16F10 cells. The above results were verified by in vivo experiments. In addition, viability of B16F10 cells under long-time administration culture in vitro decreased after drug withdrawal, and similar results were also observed in 4T1 cells. CONCLUSIONS: Long-time administration of PAC can significantly inhibit viability and promote apoptosis of tumor cells, and had obvious antitumor effect in tumor-bearing mice.

Removing polyfluoroalkyl substances (PFAS) from wastewater with mixed matrix membranes.

Polyfluoroalkyl and perfluoroalkyl (PFAS) chemicals are fluorinated and exhibit complicated behavior. They are determined and highly resistant to ecological modifications that render plants ecologically robust. Thermal stability and water and oil resistance are examples of material qualities. Their adverse consequences are causing increasing worry due to their bioaccumulative nature in humans and other creatures. Direct data indicates that PFAS exposure in humans causes endocrine system disruption, immune system suppression, obesity, increased cholesterol, and cancer. Several PFASs are present in drinking water at low doses and may harm people. These cancer-causing PFAS have caused concern for water bodies all around the globe. Analytical techniques are used to identify and measure PFAS in an aqueous medium (membrane). Furthermore, a deeper explanation is provided for PFAS removal methods, including mixed matrix membrane (MMM) technology. By removing over 99 % of the PFAS from wastewater, MMMs may effectively remove PFAS from sewage when the support matrix contains adsorbing components. Furthermore, we consider several factors affecting the removal of PFAS and practical sorption methods for PFAS onto various adsorbents.

Carboxyl and polyamine groups functionalized polyacrylonitrile fibers for efficient recovery of copper ions from solution.

Heavy metals (e.g., Cu) in wastewater are attractive resources for diverse applications, and adsorption is a promising route to recovery of heavy metals from wastewater. However, high-performance adsorbents with high adsorption capacity, speed, and stability remain challenging. Herein, chelating fibers were prepared by chemically grafting amine and carboxyl groups onto the polyacrylonitrile fiber surface and used in the wastewater's adsorption of Cu2+. The adsorption behavior of Cu2+ on the fibers was systematically investigated, and the post-adsorption fibers were comprehensively characterized to uncover the adsorption mechanism. The results show that chelated fiber has a 136.3 mg/g maximum capacity for Cu2+ adsorption at pH = 5, and the whole adsorption process could reach equilibrium in about 60 min. The adsorption process corresponds to the quasi-secondary kinetic and Langmuir models. The results of adsorption, FTIR, and XPS tests indicate that the synergistic coordination of -COOH and -NH2 plays a leading role in the rapid capture of Cu2+. In addition, introducing hydrophilic groups facilitates the rapid contact and interaction of the fibers with Cu2+ in the solution. After being used five times, the fiber's adsorption capacity remains at over 90% of its original level.

Persistent free radicals on biochar for its catalytic capability: A review.

Biochar is an economical carbon material for water pollution control, which shows great promise to be applied in the up-scale wastewater remediation processes. Previous studies demonstrate that persistent free radicals (PFRs) on biochar are critical to its reactivity for wastewater remediation. A series of studies have revealed the important roles of PFRs when biochar was applied for organic pollutants degradation as well as the removal of Cr (VI) and As (III) from wastewater. Therefore, this review comprehensively concludes the significance of PFRs for the catalytic capabilities of biochar in advanced oxidation processes (AOPs)-driven organic pollutant removal, and applied in redox processes for Cr (VI) and As (III) remediation. In addition, the mechanisms for PFRs formation during biochar synthesis are discussed. The detection methods are reviewed for the quantification of PFRs on biochar. Future research directions were also proposed on underpinning the knowledge base to forward the applications of biochar in practical real wastewater treatment.

Comparison of Short-Term Surgery Outcomes and Clinical Characteristics Between Elderly and Non-Elderly Patients with Middle Third Parasagittal and Parafalcine Meningiomas.

Purpose: This study aims to compare the short-term surgery outcomes of the resection of meningiomas and clinical characteristics between elderly and non-elderly patients. Patients and Methods: This retrospective study included patients who underwent a resection of middle third parasagittal and parafalcine meningiomas between January 2011 and December 2020. All lesions arise from the middle third of the parafalcine or infiltrate superior sagittal sinus (SSS). The clinical characteristics studied included neurological deficit, peritumoral brain edema (PTBE), SSS invasion, tumor size, and symptoms; perioperative complications, and short-term surgery outcomes including neurological deficit, operative blood loss, postoperative hospitalization duration, and WHO classification were compared. Results: A total of 43 elderly patients and 63 non-elderly patients were included. Compared with non-elderly patients, elderly patients had larger lesions (P = 0.013) and presented with a larger PTBE (P = 0.019). SSS blockage was identified in 28.57% of elderly patients and 19.57% of non-elderly patients. Compared with non-elderly patients, elderly patients tended to suffer from more aggressive lesions (WHO II/III meningioma 6 vs 3, P = 0.154) and presented with longer postoperative hospital stays (17.25 ± 5.8 vs 13.50 ± 3.8, P = 0.009); conversely, while the non-elderly patients experienced more blood loss (P = 0.022) and had more perioperative reoperations (3 vs 1). No significant difference in neurological deficit was detected between the two groups (P = 0.97). After total tumor resection, patients with neurological deficits in both groups can recover during the follow-up period. Conclusion: Among the 106 patients with middle third parasagittal and falx meningiomas in our hospital, elderly patients had larger lesions, presented with more severe PTBE, and had longer postoperative hospital stays than younger patients. Conversely, younger patients had more blood loss and serious complications than elderly patients. Postoperative neurological dysfunction in elderly patients was similar to that in middle-aged and young patients.

Three-dimensional electro-neural interfaces electroplated on subretinal prostheses.

Objective: High-resolution retinal prosthetics offer partial restoration of sight to patients blinded by retinal degenerative diseases through electrical stimulation of the remaining neurons. Decreasing the pixel size enables an increase in prosthetic visual acuity, as demonstrated in animal models of retinal degeneration. However, scaling down the size of planar pixels is limited by the reduced penetration depth of the electric field in tissue. We investigate 3-dimensional structures on top of the photovoltaic arrays for enhanced penetration of electric field to permit higher-resolution implants. Approach: We developed 3D COMSOL models of subretinal photovoltaic arrays that accurately quantify the device electrodynamics during stimulation and verified it experimentally through comparison with the standard (flat) photovoltaic arrays. The models were then applied to optimise the design of 3D electrode structures (pillars and honeycombs) to efficiently stimulate the inner retinal neurons. The return electrodes elevated on top of the honeycomb walls surrounding each pixel orient the electric field inside the cavities vertically, aligning it with bipolar cells for optimal stimulation. Alternatively, pillars elevate the active electrode into the inner nuclear layer, improving proximity to the target neurons. Modelling results informed a microfabrication process of electroplating the 3D electrode structures on top of the existing flat subretinal prosthesis. Main results: Simulations demonstrate that despite the conductive sidewalls of the 3D electrodes being exposed to electrolyte, most of the charge flows via the high-capacitance sputtered Iridium Oxide film that caps the top of the 3D structures. The 24 µm height of the electroplated honeycomb structures was optimised for integration with the inner nuclear layer cells in rat retina, while 35 µm height of the pillars was optimized for penetrating the debris layer in human patients. Release from the wafer and implantation of the 3D arrays demonstrated that they are mechanically robust to withstand the associated forces. Histology demonstrated successful integration of the 3D structures with the rat retina in-vivo. Significance: Electroplated 3D honeycomb structures produce a vertically oriented electric field that offers low stimulation threshold, high spatial resolution and high contrast for the retinal implants with pixel sizes down to 20µm in width. Pillar electrodes offer an alternative configuration for extending the stimulation past the debris layers. Electroplating of the 3D structures is compatible with the fabrication process of the flat photovoltaic arrays, thereby enabling much more efficient stimulation than in their original flat configuration.